Homologous and Analogous

Homologous Structures

It’s obvious enough to say that the homologous structure that these animals have is a hand, wing, flipper or paw. All in which help them live and do everything our human hand would personally need as well. As a human, we know that our hands are very important and everything we do incorporates the use of them.

Organs as different as a bat's wing, a seal's flipper, a cat's paw and a human's hand have a common underlying structure, with identical or very similar arrangements of bones and muscles. In 1843 Richard Owen reasoned that there must be a common structural plan for all vertebrates, as well as for each class of vertebrates. He called this plan the archetype. Richard Owen also distinguished homology from analogy, which he defined as a 'part or organ in one animal which has the same function as another part or organ in a different animal'.

Homologous structures are structures that are derived from a common ancestor; they have a 

common evolutionary ancestry. This is not to say that homologous structures have the same 

function, a whale's flipper is homologous to a human arm. These limbs are superficially different, but their internal skeletal structure is essentially the same. 

Bat's Wing

Helping them fly, allowing bats to maneuver more quickly and more accurately than birds. 

Seal Fin

On land, the use the flippers to drag hind limbs and in the water, using primarily 

their hind flippers for propulsion and their front flippers as rudders for steering.

Cat Paw

Cat's walk on their toes, providing sure footing for their hind paws when they 

navigate rough terrain. Also any other necessity a human hand can do, a paw is able.

Human Hand

As human's we use our hands to do every action in our lives. As human's life would be extremely 

hard and nearly impossible to do much without such a limb. 

Common Ancestor:

A common ancestor amongst all these animals would have to be a mammal. Mammal's all need 

some type of  limb to have multi-functions as in this does.

Analogous Structure


Octopus Eye vs Human Eye

Octopus Eye

Cephalopods as active marine predators, possess sensory organs specialized for use in aquatic conditions. They have a camera-type eye, which consists of a lens projecting an image onto a retina. Unlike the vertebrae camera eye, the cephalopod's form as invaginations of the body surface, and consequently they lack a cornea. A cephalopod eye is focused through movement, much like the lens of a camera or telescope, rather than changing shape as the lens in the human eye does. The eye is approximately spherical, as is the lens, which is fully internal. 

Human Eye

The human eye is an organ which reacts to light for several purposes. As a conscious sense organ, the mammalian eye allows vision. Rod and cons cells in the retina allow conscious light perception and vision including color differentiation and the perception of depth. The human eye can distinguish about 10 million colors. In common with the eyes of other mammals, the human's eye non-image-forming photosenitive ganglion cells in the retina receive the light signals which affect adjustment of the size of the pupil, regulation, and suppression of the hormone melatonin and entrainment of the body clock.

Analogous Trait

Something known as the "camera eye" is what the octopus eye and the human eyes both evolved from. The name "camera eye" came from consisting of a lens projecting a representation onto a retina. The common ancestor of the octopus and of man possessed this analogous trait and modified it so it could see.

Common Ancestors:

Their common ancestor lived more than one-half billion years ago. Since it did not have a camera-like eye (like they now do), the fact that humans exchange a simple gaze with octopuses can only mean that such an eye evolved independently. This is a classic example of parallel evolution, the emergence of a similar biological feature, not be a descent from a common ancestor. But from organisms that are effectively unrelated. Yet biologists also know that this eye-type has evolved independently at least four other times. Both octopus and humans end up seeing in much the same way, even though their respective ancestors could not.

Apes Evolving into Students?

Can you decode me? Lets see if I understand mRNA to DNA.

ATTGAAATGCCAAGTGAGCTCAGCTAGGTAAGCCG

Beware of that start codon! Locate it! Have fun!

How does Evolution work?

One of the most influential philosophers that contribute to Charles Darwin’s theory was from Charles Lyell. Lyell’s theory of geology came from the idea of uniformitarianism. Best defined as the assumption that the same natural processes that function in the universe now, have always operated in the universe in the past and apply everywhere in the universe. Lyell would conclude that Earth was made of many gradual slow changes made into what we know today.  Similar to Darwin, Lyell had a thoughtful effect on our understanding of life's history. Lyell influenced Darwin so intensely that Darwin viewed evolution as a sort of biological uniformitarianism. Evolution took place from one generation to the next, he argued, but it worked too slowly for us to perceive.

< http://evolution.berkeley.edu/evolibrary/article/history_12>

How does Evolution work?

n order for traits to evolve and change, they MUST be heritable. This is one of the points that I definitely find to be of Lyell’s understanding. Darwin could not seem to find an understanding to how traits were passed on. But from Lyell’s beliefs, he finds that over a long course of time things change. Just like theis traits have been passed down and eventually changing over a long course of time, producing generation after generation.
If the environment changes, the traits that are helpful or adaptive to that environment will be different. As Lyell in his theories, mentions that He found evidence for many rises and falls of sea level, volcanoes construct on top of much older rocks. Natural processes such as earthquakes and eruptions, which had been witnessed by humans, were enough to produce mountain ranges. Now only were valleys the work from huge floods but they slowly were the grinding from a intense force of wind and water. As the environments were changing by natural processes, traits that were adaptive lived in the surroundings. Lyell was a huge believer in environments naturally changing and how the world will slowly change, only those who could adapt would survive. Darwin must of found Lyell’s beliefs in this topic something he could grow from.

Darwin and Natural Selection: I do not find Charles Darwin’s theory on natural selection to be that connected with the work from Charles Lyell. Don’t get me wrong, I do think Charles Darwin would not have gotten this far in his work without knowing what Lyell did first, but I think Darwin’s thoughts on natural selection were stemmed from his thoughts on evolution in geology that came first. From the evolution of geology which Lyell thought took so long overtime, Darwin interpreted that to the idea of people evolving over time.
The church found that religion and science could never meet hand in hand. The book shaped a variety of religious responses at a time of altering ideas at this time. Developments in geology meant that there was little hostility based on a literal reading of Genesis, but defense of the argument from design and natural theology was central to debates over the book in the English speaking world. The church of English interpreted the idea of Natural Selection to be an instrument of God's design. Even though the book had hardly implied to human evolution, it rapidly became vital to the debate as psychological and moral qualities were seen as spiritual aspects of the irrelevant soul, and it was believed that animals did not have spiritual traits. This divergence could be submissive by supposing there was some supernatural intervention on the path leading to humans, or interpreting evolution as a decisive and progressive rise to mankind's position at the head of nature.