tag:blogger.com,1999:blog-31222390099360885062024-02-01T22:14:39.965-08:00Anthropology BlogAnonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.comBlogger7125tag:blogger.com,1999:blog-3122239009936088506.post-85236783604297471932012-07-31T16:48:00.001-07:002012-07-31T16:48:18.023-07:00Human Variation! Last Post!<br />
<div class="MsoListParagraphCxSpFirst" style="mso-list: l0 level1 lfo1; text-indent: -.25in;">
<!--[if !supportLists]-->1.<span style="font-size: 7pt;">
</span><!--[endif]-->In the colder climates, humans responses to the environment
in many ways. Positively there is an increase in basal metabolic rate, fat
insulation, and change in blood flow. More importantly, the negative effects
are reactions such as hypothermia. Due to concentration of body heat in the
torsos, there was a loss of fingers, toes to create a severe frostbite. </div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="MsoListParagraphCxSpMiddle" style="mso-list: l0 level1 lfo1; text-indent: -.25in;">
<!--[if !supportLists]-->2.<span style="font-size: 7pt;">
</span><!--[endif]-->Short-term adaptation: It is a stress with a
short and quick response; it maintains homeostasis in an orderly immediate
matter. An example would be shivering when the climate is cold. </div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAjxbTuDyQTRvZjiFHhTP_-plPq3ejaJZzpqOACIJ6l9kdboByZkwwZ83DvF7FlPbEII2QMKLJCH94KzmQC7HZSOHo0XXcLral3278khffV1mnAx5a8q1Xv825aL5LhawLYc9GKdOhQCY/s1600/anthro01.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgAjxbTuDyQTRvZjiFHhTP_-plPq3ejaJZzpqOACIJ6l9kdboByZkwwZ83DvF7FlPbEII2QMKLJCH94KzmQC7HZSOHo0XXcLral3278khffV1mnAx5a8q1Xv825aL5LhawLYc9GKdOhQCY/s1600/anthro01.jpg" /></a></div>
<div class="MsoListParagraphCxSpMiddle">
<o:p><br /></o:p></div>
<div class="MsoListParagraphCxSpMiddle">
<o:p><br /></o:p></div>
<div class="MsoListParagraphCxSpMiddle">
Facultative adaptation: These are genetic
traits that involve turning genes on/off to alter a phenotype in the environment,
not a change in the DNA of the organism. As long as the stress is applied, the
phenotype will be adjusted but can return to the normal mode when stress is
released. Just as in when someone stands upside down, all the blood races to
your head; when you return to right side up again, then the blood will return
to all the appropriate places.</div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpiQnP0IsB25_v8qq9vGHG9QM8yJSpkU3i1FMQZFZ5jQQh98pBiHp8yqVFgEOTuhMX-5FQrb5xxN5_TJX3kA4yXSAuXSdP7Vv5uzyejjQdfX44mwuruOhvfxHYj-e2mpbMux4GJR4BrRk/s1600/anthro02.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpiQnP0IsB25_v8qq9vGHG9QM8yJSpkU3i1FMQZFZ5jQQh98pBiHp8yqVFgEOTuhMX-5FQrb5xxN5_TJX3kA4yXSAuXSdP7Vv5uzyejjQdfX44mwuruOhvfxHYj-e2mpbMux4GJR4BrRk/s1600/anthro02.jpg" /></a></div>
<div class="MsoListParagraphCxSpMiddle">
<o:p><br /></o:p></div>
<div class="MsoListParagraphCxSpMiddle">
<o:p><br /></o:p></div>
<div class="MsoListParagraphCxSpMiddle">
Developmental
adaptations: These traits can only change through long terms, generations at a
time, an individual does not have the power to adjust. The long-term stress is
applied with evolutionary forces. In warm climates, the people tend to be
slimmer because of the heat they do not want to retain. </div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0M3VgpXNCBJiT1s-JHy73ZmM-iCASCRw3JwmAWwnDEQRCTkrZxNR064q9CBOFJrq0r41WvhHTavwrFjCs2z3uEIQ_yZaU4NYtzo-OEyzstcGwMOrJOoNXllSU35D5yvF_9FgDuBdm2U0/s1600/anthro03.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi0M3VgpXNCBJiT1s-JHy73ZmM-iCASCRw3JwmAWwnDEQRCTkrZxNR064q9CBOFJrq0r41WvhHTavwrFjCs2z3uEIQ_yZaU4NYtzo-OEyzstcGwMOrJOoNXllSU35D5yvF_9FgDuBdm2U0/s1600/anthro03.jpg" /></a></div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="MsoListParagraphCxSpMiddle">
Cultural adaptations: Humans, with culture,
can help to adapt to environmental stresses on occasion. Cultural adaptations
include social behaviors, practices, tools, diet and more. An example is how we
dress according to where we live.</div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2w1AcZKanKuPbFo0eURiJH641WJBD478EFQbP9yoyNqNS7zLKgbiHCBx_msT4sXH7maAEkwitLgZVwEZ9Vj5hyphenhyphen4uSeett-AOH6wvgjL5Dgn7ki2AKdJpLe4wP3ZqyF58soZuW7z20mDI/s1600/antho04.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh2w1AcZKanKuPbFo0eURiJH641WJBD478EFQbP9yoyNqNS7zLKgbiHCBx_msT4sXH7maAEkwitLgZVwEZ9Vj5hyphenhyphen4uSeett-AOH6wvgjL5Dgn7ki2AKdJpLe4wP3ZqyF58soZuW7z20mDI/s320/antho04.jpg" width="233" /></a></div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="MsoListParagraphCxSpMiddle">
<br /></div>
<div class="MsoListParagraphCxSpLast" style="mso-list: l0 level1 lfo1; text-indent: -.25in;">
<!--[if !supportLists]-->3.<span style="font-size: 7pt;">
</span><!--[endif]-->Human variation is very interesting; humans are
all the same but cultural and environmental situations alter the way everyone
acts, feel and treat one another. In order to understand how humans think,
respond and act you must have a deeper understanding of where they come from.
This can truly positively affect everyone. For instance, I am moving to North Carolina
next week. In order for me to understand that culture, I have to pay attention
to what they eat, how they dress, and the different accent they have. I need to
understand that their living is much slower than Los Angeles, what I’m used to.
To understand other people, you need to put it into perspective.</div>
<div class="MsoListParagraphCxSpLast" style="mso-list: l0 level1 lfo1; text-indent: -.25in;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_zQiRTYHps-PM4SYMofxJDmXwbuqpcKWS3C2jmPkqLZt_MPnVW90S1T12uYBai4rcJ_6qr6o4QqeuIaK3dYDW9rHIs1Jywl0QJawO2e6EdeElOJRN0os9W_xF-5x5XvjN9zJMAo4_Ilg/s1600/anthor05.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi_zQiRTYHps-PM4SYMofxJDmXwbuqpcKWS3C2jmPkqLZt_MPnVW90S1T12uYBai4rcJ_6qr6o4QqeuIaK3dYDW9rHIs1Jywl0QJawO2e6EdeElOJRN0os9W_xF-5x5XvjN9zJMAo4_Ilg/s320/anthor05.jpg" width="320" /></a></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoListParagraph" style="mso-list: l0 level1 lfo1; text-indent: -.25in;">
<!--[if !supportLists]-->4.<span style="font-size: 7pt;">
</span><!--[endif]-->Different races are understood with the
adaptation to variations. Cultural adaptations are the only adaptation that
makes complete sense to me. It is defined to help adapt to the environmental stresses
when necessary. This the social behaviors, tools, food, practices, and
clothing; the understanding between how races are, becomes a happy median to
how these cultures will adapt with others. It’s hard to explain human variation
because we are all similar but with the exception of cultural environments, we
tend to be very different amongst races. That needs to be very much understood.</div>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com2tag:blogger.com,1999:blog-3122239009936088506.post-56221167110644067042012-07-23T00:05:00.001-07:002012-07-23T00:05:24.170-07:00Language Deficits<br />
<h4 style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><span style="font-size: 12pt; font-weight: normal; line-height: 115%;">Part 1:</span></span></h4>
<h4>
<span style="font-family: Georgia, 'Times New Roman', serif; font-weight: normal;"><span style="font-size: 12pt; line-height: 115%;"><br /></span><span style="font-size: 12pt; line-height: 115%;"> I
found this assignment completely difficult. Maybe it was because I have no
patience, but only being able to speak with your eyes and facials is so
unrealistic within communicating. I found this to be quite a tricky assignment;
I am a very verbal/talkative person.</span><span style="font-size: 12pt; line-height: 115%;"> My
partner had a harder time than I did in this assignment. I thought I was bad
but we just couldn’t get on the same understanding level in this situation.
After when we talked about what we were trying to communicate, it had nothing
to do with what actually was needed to be conversed.</span><span style="font-size: 12pt; line-height: 115%;"> I
feel in the situation of this “no symbolic communication”, hypothetically if it
represented two different cultures, it would be very confusing. It reminds me
directly of how Americans met Native Americans back in the day, making
understanding between the two foreign cultures difficult. I think the symbolic
language has the upper hand because language doesn’t help someone that cannot
understand, facials would do better work in that case. Frustration would arise
from the speaking culture because it would not do them any good, talking to
someone that completely cannot comprehend what’s going on. In this case,
non-verbal has a lot of power to these two diverse cultures. In our culture
directly, we are a diverse state of California with many Hispanics that do not
speak fluent English, if at all. That could be a big discrepancy in our system,
how Americans and Hispanics cannot fully communicate to their best ability. We
use multi-cultural workers in our society to our advantage at different work
places. Someone who can speak both Spanish and English is a very valued gift to
California worker places.</span></span></h4>
<h4>
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif; font-weight: normal; line-height: 18px;"><br /></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif; font-weight: normal;"><div style="text-align: center;">
<span style="background-color: white; font-size: 12pt; line-height: 115%;">Part 2:</span></div>
</span></h4>
<h4>
<span style="font-family: Georgia, 'Times New Roman', serif; font-weight: normal;"><span style="font-size: 12pt; line-height: 115%;"><br /></span><span style="font-size: 12pt; line-height: 115%;"> I
do not feel as if this type of communication was that harsh. Yes it was
difficult at times but nothing like the first assignment. I use my hands a lot
so multiple times I just had to sit on my hands and not wiggle my body. But using
words came easier for me.</span><span style="font-size: 12pt; line-height: 115%;"> My
partner as I had a decent time with this particular assignment. I don’t know
but after the first part of the assignment this one came to us much easier.</span><span style="font-size: 12pt; line-height: 115%;"> I
find non-speech techniques to be extremely important in society and how we
communicate today. I can say it makes things easier to use those facials and
point when talking specifically about something, but if two people speak the
same language, you might as well us it to your fullest capabilities.</span><span style="font-size: 12pt; line-height: 115%;"> There
are always those people who find difficulty in reading body language. I would
say obviously this would not help blind people in any way at all, which would
be completely impossible. I feel like being a people person would help someone
comprehend reading body language well, it would benefit the socialable person greatly,
people that come into contact with people often. Environment situations where
this would not benefit the persons, this is quite a hard question. Honestly I cannot
put the situation into perspective enough to find a valid example, which doesn’t
give an answer. But nothing reasonable is coming to mind! Because most places using language is the easier option and using gestures is easier to go without. Maybe on a sporting field while playing a game, that could be nearly impossible not to move, use gestures or point.</span></span></h4>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com3tag:blogger.com,1999:blog-3122239009936088506.post-45629181170822580972012-07-10T12:27:00.003-07:002012-07-10T12:27:19.377-07:00WHO DONE IT?<br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgm2Cpwfc-gO8135E7MkVGcR4sH_It6NjTNe_sS3xITJlBcHS6GvSqfcHKo-Jrdt09RVu4mPpnKdRoufiCEbaBYlLayqJ1RBjAD4EFx1y-av4yaad_8zQg-d_rjKGJdpf6u8T2-JN9K-1U/s1600/anthro2.gif" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgm2Cpwfc-gO8135E7MkVGcR4sH_It6NjTNe_sS3xITJlBcHS6GvSqfcHKo-Jrdt09RVu4mPpnKdRoufiCEbaBYlLayqJ1RBjAD4EFx1y-av4yaad_8zQg-d_rjKGJdpf6u8T2-JN9K-1U/s320/anthro2.gif" width="236" /></a></div>
<div style="background-color: white; background-position: initial initial; background-repeat: initial initial; margin: 4.8pt 0in 6pt; text-indent: 0.5in;">
<span style="line-height: 15.9pt;"><br /></span></div>
<div style="background-color: white; background-position: initial initial; background-repeat: initial initial; margin: 4.8pt 0in 6pt; text-indent: 0.5in;">
<span style="line-height: 15.9pt;"><span style="font-family: Arial, Helvetica, sans-serif;"><br /></span></span></div>
<div style="background-color: white; background-position: initial initial; background-repeat: initial initial; margin: 4.8pt 0in 6pt; text-indent: 0.5in;">
<span style="font-family: Arial, Helvetica, sans-serif;"><span style="line-height: 15.9pt;">The</span><span class="apple-converted-space" style="line-height: 15.9pt;"> </span><span style="line-height: 15.9pt;">Piltdown hoax consisted of a man in which bone fragments were
presented as the</span><span class="apple-converted-space" style="line-height: 15.9pt;"> </span><span style="line-height: 15.9pt;">fossilized</span><span class="apple-converted-space" style="line-height: 15.9pt;"> </span><span style="line-height: 15.9pt;">remnants of a previously unknown early human.
In 1912 from a gravel pit in Piltdown, East Sussex, England; the remains of the
parts were of a skull and jawbone.
The collector of these bone fragments was Charles Dawson. The significance of
the specimen remained the subject of controversy until it was exposed in 1953
as a forgery, consisting of the lower jawbone of an</span><span class="apple-converted-space"><span style="line-height: 15.9pt;"> </span><span style="line-height: 21px;">orangutan. Which</span></span><span style="line-height: 15.9pt;"> has been deliberately combined
with the skull of a fully developed modern human</span><span style="line-height: 15.9pt;">.
The Piltdown hoax is perhaps the most famous paleontological hoax ever. It has
been prominent for two reasons: the attention paid to the issue of human</span><span class="apple-converted-space" style="line-height: 15.9pt;"> </span><a href="http://en.wikipedia.org/wiki/Evolution" style="line-height: 15.9pt;" title="Evolution"><span style="color: windowtext; text-decoration: none; text-underline: none;">evolution</span></a><span style="line-height: 15.9pt;">, and the length
of time, more than 40 years that elapsed from its discovery to its full
exposure as a fake.</span></span></div>
<div style="background: white; line-height: 15.9pt; margin-bottom: 6.0pt; margin-left: 0in; margin-right: 0in; margin-top: 4.8pt; text-indent: .5in;">
<span style="font-family: Arial, Helvetica, sans-serif;">The Piltdown man hoax had succeeded so well because, at the
time of its discovery, the scientific establishment had believed that the large
modern brain had preceded the modern omnivorous diet, and the forgery had
provided exactly that evidence. It has also been thought that nationalism and
cultural prejudice played a role in the less-than-critical acceptance of the
fossil as genuine by some British scientists.<span class="apple-converted-space"> </span>It
pleased European expectations that the earliest humans would be found in<span class="apple-converted-space"> </span><a href="http://en.wikipedia.org/wiki/Eurasia" title="Eurasia"><span style="color: windowtext; text-decoration: none; text-underline: none;">Eurasia</span></a>, and the British, it has been claimed, also wanted a<span class="apple-converted-space"> </span>first
Briton<span class="apple-converted-space"> </span>to set against
fossil hominids found elsewhere in Europe, including France and Germany.<o:p></o:p></span></div>
<div class="MsoNormal" style="text-indent: .5in;">
<span style="font-family: Arial, Helvetica, sans-serif;"><span style="line-height: 115%;">An imperfection that our society is accustomed to human
nature, we make faults more frequently than we know. In this situation
concerning the hoax, one man found responsibility for the discovery; his name
was Sir Arthur Conan Doyle, creation of Sherlock Holmes. Amongst his “findings”,
was the idea of revenge he had amongst the scientific community because they
joked of his beliefs on spiritualism. He thoroughly believed in communication
with the deceased, in which this rational society did not condone. But looking
back at the situation, hypothetically if this was indeed a hoax, why would he
have geared a prank towards more humiliation. Another suspect was the man
initially to find Charles Darwin, the philosopher known for so many important
findings in science and evolution. This suspect had a lot to prove in order to
climb the ladder of scientific discovery and ambition. To this day, he indeed
is still the highest ranked suspect on this matter. To this day, who knows who
it could really be.</span><span style="line-height: 115%;"><o:p></o:p></span></span></div>
<div class="MsoNormal" style="text-indent: .5in;">
<span style="line-height: 115%;"><span style="font-family: Arial, Helvetica, sans-serif;">It is a huge upset that
this was all a hoax, but with an upside to it all, initially the science
reputation was saved. Hypotheses were tested time and time again, also did the
theories; they must be falsifiable and maybe even Piltdown man would come
through. Giles Oakley performed all the tests on the bones to determine somewhat
of an age amongst them. The bones involved were tested with chemicals to
determine a particular age. It was soon determined that these bones were much
younger than originally known to be. They then tested the amount of nitrogen
contained, later showing us that the skull was not very old at all. Even though
this forgery lastest almost forty years in the making of some truth, it was
still the scientific method that eventually proved to be counterfeit. <o:p></o:p></span></span></div>
<div class="MsoNormal">
<br /></div>
<div class="MsoNormal" style="text-indent: .5in;">
<span style="line-height: 115%;"><span style="font-family: Arial, Helvetica, sans-serif;">There is no denying
that human flaws are avoidable, because they are definitely inevitable. The
humans we have been raised to become, will always understand errors. Human
qualities that are good in the nature of us humans are amongst: trust, belief, dedication
and aspiration. Without such qualities within our existence, there would be no
science and testing out the uncertain. This may have been a hoax but in a more
understanding sense, mistakes do occur. </span><span style="font-family: 'Times New Roman', serif; font-size: 12pt;"><o:p></o:p></span></span></div>
<div class="MsoNormal">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgiSnoUGk3lW2LmMTU0ShH9oKXImxpiJt_strKbf4a_tGiDddnY73zBTZ8HOp7kpK-sKAmOOmu1x3ICLtbTlZ_HMUP0xZwVhzjVKtE21g4P1qHMD0B37UekgbF86E212zwZ5LNnTNhZE2k/s1600/anthro3.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgiSnoUGk3lW2LmMTU0ShH9oKXImxpiJt_strKbf4a_tGiDddnY73zBTZ8HOp7kpK-sKAmOOmu1x3ICLtbTlZ_HMUP0xZwVhzjVKtE21g4P1qHMD0B37UekgbF86E212zwZ5LNnTNhZE2k/s1600/anthro3.jpg" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjA1o_xxO9W-ts7207xZhyx-XI1HIP8hkhX4XTmS6lzXpObo5aHGDdqJj2S0dXK7Glm-ScCtUvQ40L1Ky2Zg4y_4GXJ5B3d_4Kes367w-aImJrs_tH4Y4vg06zR3P4bKN4zUxC4rXceR5w/s1600/anthro1.gif" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjA1o_xxO9W-ts7207xZhyx-XI1HIP8hkhX4XTmS6lzXpObo5aHGDdqJj2S0dXK7Glm-ScCtUvQ40L1Ky2Zg4y_4GXJ5B3d_4Kes367w-aImJrs_tH4Y4vg06zR3P4bKN4zUxC4rXceR5w/s1600/anthro1.gif" /></a></div>
<div class="MsoNormal">
<span style="font-family: "Times New Roman","serif"; font-size: 12.0pt; line-height: 115%;"><br /></span></div>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com6tag:blogger.com,1999:blog-3122239009936088506.post-91733022685718681312012-07-05T23:07:00.004-07:002012-07-05T23:24:57.066-07:00Primates: Locomotor and Learning<br />
<br />
<div style="text-align: center;">
<b style="background-color: white;"><span style="font-family: Georgia, 'Times New Roman', serif;">Lemurs:</span></b><br />
<b style="background-color: white;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></b><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhck-uc-dk8H182bj-7xSRlWdW6Wvaz2xOjwYfvPbvrv4j80J226MPfKwG_s8-OV_ZO3xxXvTs7yVxSyhIW4fhbPytoWNDH_SLS9TGyvXKRyPAgodMja04XcTzhR6TuajyjU52bcbrN2Ug/s1600/anthropic1.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="210" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhck-uc-dk8H182bj-7xSRlWdW6Wvaz2xOjwYfvPbvrv4j80J226MPfKwG_s8-OV_ZO3xxXvTs7yVxSyhIW4fhbPytoWNDH_SLS9TGyvXKRyPAgodMja04XcTzhR6TuajyjU52bcbrN2Ug/s320/anthropic1.jpg" width="320" /></a></div>
<b style="background-color: white;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></b></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Description of where they live:</i> </span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> This
type of primate, the lemur, lives amongst the trees in forests. Forest midlevel
and up, is where you are most to find a lemur, except the ring-tailed lemur
which is mostly on the ground level. Lemurs
are usually diurnal, meaning that they are active and awake during the day,
while night time is all about sleep. There are some lemurs, whom are of the
smaller stature (“mouse” lemurs or “dwarves” as they are called) that are
nocturnal.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Description of this primate’s character trait:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Lemurs
are herbivores, having a diet consisting of mainly leaves and fruits. Cheirogaleidae (dwarves), a family of lemurs,
has a diet of fruit and prey such as insects, frogs, etc. Indriidae, another
family of lemurs, eats strictly as vegetarians. Daubentoniidae, the last of the
lemur family’s, are primarily carnivorous, their prey consists of insects, eggs
and birds.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Description of Primate’s trait that influences Environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Many of
these lemurs live high amongst the trees, making it easier and more convenient
to be in reach of their food. Because they live in such tropical forest-like
places, their diet consisting of fruits, plants, and small insects are easy to
come by.<br /><o:p> </o:p></span><br />
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;">Spider Monkey:</b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgUxp7Nw8-0LEJ1lN363fqutdDe7NAQ-Q1qUS9zIhOOaHGstaI56WTNOiDDXG1J7DRBf8sP0oLQDg_paPSCpbkJEDKmzKSMEM7yzVxqwNQb3H10k6IBK5XAMsGtQJkHGMjGNG10Cx2XRfA/s1600/anthropic2.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgUxp7Nw8-0LEJ1lN363fqutdDe7NAQ-Q1qUS9zIhOOaHGstaI56WTNOiDDXG1J7DRBf8sP0oLQDg_paPSCpbkJEDKmzKSMEM7yzVxqwNQb3H10k6IBK5XAMsGtQJkHGMjGNG10Cx2XRfA/s320/anthropic2.jpg" width="320" /></a></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Description of where they live:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> New world monkeys live in arboreal
habitats throughout the Amazonian ecosystem and the neotropics. They occupy a
variety of niches by adapting to different food sources located at different
vertical levels in the forest. The resources of a particular tropical forest
without directly competing.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Description of primate’s character trait:</i></span><br />
<span style="background-color: white; font-family: Georgia, 'Times New Roman', serif;"> </span><span style="font-family: Georgia, 'Times New Roman', serif;">They play a role in the food chairs
for consuming fruits and nuts. Spider Monkey’s get consumed by jaguars, harpy
eagles, or small cats called ocelots. However, they are particularly effective
as seed dispersers, both in terms of quantity and quality. Being a spider
monkey, their diet consists of about 90 percent fruits and nuts. They eat the
fruits of many big forest trees, and because it swallows fruits whole, the
seeds will eventually pass out. Spider monkeys are diurnal and most of the
feeding happens between dawn and 10 am. After the morning feeding, the adults
typically rest while the young play. Throughout the rest of the day, they may
feed infrequently around 10pm or so. If their food is low, they can always
resort to eating insects, bark, and rotting forest, and honey. The spider
monkey has a unique way of getting food because there is a lead female
responsible for feeding. If she cannot find enough food for the entire group,
they split into smaller ones to find food easier.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Describe the Primate’s trait influencing environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Spider
Monkeys live in forest areas, mostly within the Central and South American
areas, they can adapt to different fruits found amongst forests in order to
compete for food to survive. They also eat the insects that they found in the
leaves that they eat, so there is ways of changing and adapting to their
eating, although they are known for eating almost anything. The main problem
that they are facing is the competiting of the same kind of fruit amongst one
another.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span><br />
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;">Baboon:</b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh0R8sB1GVT1TmpoRL45GPoix0gjJmFbAyShgXgtS0jdTlb8m7Umz9IQSfUUEAvLeKZlKZWsuGaCAl2o_FKWYJpbTVCD7uQKU6lly7OyNmR9NwyDEPnaGBzfBOILtPxGGvTczY-E5HNrjs/s1600/anthropic4.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="237" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEh0R8sB1GVT1TmpoRL45GPoix0gjJmFbAyShgXgtS0jdTlb8m7Umz9IQSfUUEAvLeKZlKZWsuGaCAl2o_FKWYJpbTVCD7uQKU6lly7OyNmR9NwyDEPnaGBzfBOILtPxGGvTczY-E5HNrjs/s320/anthropic4.jpg" width="320" /></a></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Description of Primates Living Arrangements:</i></span><br />
<span style="background-color: white; font-family: Georgia, 'Times New Roman', serif;"> </span><span style="font-family: Georgia, 'Times New Roman', serif;">These monkeys are widely
distributed in the Old World from southern Europe into NW Africa; throughout
Africa south of the Sahara; and through central and Asia. Including Southern China
and most of Japan as well. Some Ceropithecids show greater tolerance for cold
than any other non-human primates; one macaque inhabits the cold and snowy
regions of northern Japan. The steep side of gorges among the open, uplands of
Ethiopian highlands at altitudes of 2000 to 4000m. The climate is mostly cool
with heavy rainfall from June to September and very little at other times.
Mainly only grasses and stunted vegetation can survive the cold nights and
periods of drought. The earliest records of ceropithecids are from the
Oligocene of Egypt. All fossil records are from the Old World, matching the
distribution of modern species. Some extinct species were huge; one nearly
reached the side of a gorilla!</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Description of Character Trait of Primate:</i></span><br />
<span style="background-color: white; font-family: Georgia, 'Times New Roman', serif;"> </span><span style="font-family: Georgia, 'Times New Roman', serif;">Ceropithecids are divided into two
ecologically and morphologically distinct subfamilies. The Ceropithecines are
omnivorous, have cheek pouches, and simple stomachs; while the colobines are
folivorous, lack cheek pouches, and have very much complex stomach. Other
sources of food such as acacia leaves, cultivates seed crops and fruit,
represent only about five percent of its diet. Shortly after dawn, the feladas
leave their rocky gorges an clamber up onto open grasslands to graze. Since the
food they eat is of such low quality, they much forage all day to meet their
energy requirements.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>How Primate’s trait influences its direct environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Since
the kind of primate lives mostly in cold areas, it has adapted better in this
kind of climate, fruits and seeds crops only represents a little part of their
diet. It is easy to understand why since in this kind of climate, seeds and
fruits are not easy to come by. This is why in order to get their main source
of energy they eat grass because it is easily found. In a way that is why they
have developed such complex stomachs so they can basically eat whatever is found.<br /><o:p> </o:p><o:p> </o:p></span><br />
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;">Gibbons:</b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpGqCfBLlSFj12SgT8l_GQJShTXuON6UqIsVphODqRvK2vB2BWKuXYT4H5px7eTp9p2o3vkNcUXtI5GUnYF5alZB58aRk13RYMpca5QMtj4uM4V9dbJCkb2fQLpw-pEW43N-ypon-FiEc/s1600/anthropic3.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhpGqCfBLlSFj12SgT8l_GQJShTXuON6UqIsVphODqRvK2vB2BWKuXYT4H5px7eTp9p2o3vkNcUXtI5GUnYF5alZB58aRk13RYMpca5QMtj4uM4V9dbJCkb2fQLpw-pEW43N-ypon-FiEc/s320/anthropic3.jpg" width="316" /></a></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Description of Primate Environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Gibbons
are found in tropical forests of southeastern Asia, they prefer the upper
forest canopy. Amongst them is where fruits are abundant and spread branches allowing
for continuous travels. They also thrive in surviving areas of forests that
have been logged.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Description of Character Trait of Primate:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> They
are primarily vegetation, feeding on figs and other fruits, leaves and shoots.
Gibbons are omnivorous animals meaning that they eat a mixture of both plant
and animal matter. The main food of the gibbon is ripe fruit which grow around
them in the trees, and makes up around three quarters of the gibbon’s diet.
Gibbons also prey on insects, eggs, spiders and small birds.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Discussion on Primate’s trait to Influencing Environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Gibbons
have developed long arms to move from one tree to another in order to get the fruits
that constitute the most important part of their diet. They can also move pretty
fast so they are predator also for insects, spiders, and small birds. They live
in tropical environments so they can get the fruit, and develop a good
flexibility to reach the top of trees.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span><br />
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;">Chimpazee:</b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-5W8ohd8gsW9NtJ3ahwyPmXNaAn7kt3Z8D3OzHgqlIrqKy711eJ856_QhW68QrpPO25N3_3YhUCih1DOnq6s5omwgtWjEcdQRSxyweQr6YOM4UBALEYvFgsbbbpwoSjWxLLGgATjDzjI/s1600/anthropic5.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="320" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi-5W8ohd8gsW9NtJ3ahwyPmXNaAn7kt3Z8D3OzHgqlIrqKy711eJ856_QhW68QrpPO25N3_3YhUCih1DOnq6s5omwgtWjEcdQRSxyweQr6YOM4UBALEYvFgsbbbpwoSjWxLLGgATjDzjI/s320/anthropic5.jpg" width="230" /></a></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><b style="background-color: white;"><br /></b></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i>Desciption of Primate’s Enviroment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Chimpanzee’s
live in a wide variety of habitats, including tropical rain forests, woodlands,
swamp forests, and glasslands amongst Western Africa. The different subspecies
of chimpanzees live in different parts of Western and Central Africa in 21
different countries, from the Atlantic coast to well inland.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Description of Primate’s Character Trait:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Hominids
are omnivorous, primarily frugivorous or folivorous. Chimpanzees are omnivores,
eating plants and meat. They forages for food in the forests during the day, eating
leaves, fruit, seeds, tree bark, plant bulbs and more. They also enjoy eating
termites, ants and other small animals. Chimpanzees drink water, often by using
a chewed leaf as a sponge to sop up the water.</span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /><i>Discussion on Primate’s influence to the Environment:</i></span><br />
<span style="font-family: Georgia, 'Times New Roman', serif;"> Since
chimpanzees are one of the biggest yet strongest of the primates, it is not
weird that they even are able to eat young monkeys. This big size also has an
impact on the type of fruit they can get and that is why there are omnivorous
in comparison with smaller primates; that they can only live of fruits and
seeds because they can move from tree to tree more easily. The fruits are part
of their diets since their common habitat are tropical forest, also where they
can be easily found. </span><br />
<span style="font-family: Arial, Helvetica, sans-serif;"><br /></span><br />
<span style="font-family: Arial, Helvetica, sans-serif;"><br /></span><br />
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><b><u>Locomotor Patterns</u></b></span></div>
<div class="MsoNormal">
<span style="font-family: Georgia, 'Times New Roman', serif;"><br />
</span></div>
<div class="MsoNormal">
</div>
<div class="MsoNormal" style="text-align: center;">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><b>Lemurs:</b><o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"> For the most part,
Lemurs are quadrupedal, meaning they walk on all fours. However, they are also
well-known leapers and climbers.<o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 18px;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"> </span></span></div>
<div class="MsoNormal" style="text-align: center;">
<span style="line-height: 115%;"><b><span style="font-family: Georgia, 'Times New Roman', serif;">Spider Monkeys:</span></b></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"> There are many different
types of locomotion that spider monkeys may use. The type of locomotion is
quadrupedal, which is using all four limbs to walk or run. Then there is the
suspensory locomotion, which is used when hanging, climbing or moving through
trees. <o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span></div>
<div class="MsoNormal" style="text-align: center;">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><b>Baboon:</b><o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="font-family: Georgia, 'Times New Roman', serif;"><span style="line-height: 115%;"> </span><span style="background-color: white; line-height: 115%;"> </span><span style="background-color: white; line-height: 115%;">Baboons locomotor
pattern is a quadrupedal and on their digits. Walking on their digits specifically
means to walk on their toes with the heels not touching the ground. This is
known as being a digitigrades quadrupedalism.</span></span></div>
<div class="MsoNormal">
<span style="background-color: white; line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span></div>
<div class="MsoNormal" style="text-align: center;">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><b>Gibbon: </b><o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"> Gibbons main locomotor
patter is brachiating. When gibbons brachiates, they use four fingers of their
hands like a hook; they do not use their thumbs. Gibbons are known for being
very acrobatic and agile. Givvnos lives are spent mainly in trees. It is very
rate for a gibbon to be on the ground but when they are, they walk bipedally,
on two legs. Gibbons do not know how to swim, so they avoid water as best as
they can. Gibbons are also able to walk along small branches, high up in the
air and stretch their arms out to help them keep their balance.<o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span></div>
<div class="MsoNormal" style="text-align: center;">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><b>Chimpanzee:</b><o:p></o:p></span></span></div>
<div class="MsoNormal">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"> Chimpanzees usually walk
on all fours, which mean they walk on the sides of their feels and the knuckles
of their hands. However, chimpanzees can always walk upright, meaning they will
walk on their feet when they need to use their arms to carry something.
Chimpanzees are also known for their ability to swing from branch to branch in
the trees, which is known as brachiating.</span><span style="font-family: 'Times New Roman', serif;"><o:p></o:p></span></span><br />
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span><br />
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"></span></span><br />
<a name='more'></a><span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></span><br />
<div style="text-align: center;">
<span style="line-height: 115%;"><span style="font-family: Georgia, 'Times New Roman', serif;"><b><u><i>My Summary:</i></u></b></span></span></div>
<div style="text-align: center;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><span style="line-height: 18px;"><b><i><u><br /></u></i></b></span></span></div>
<div style="text-align: left;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><i><span style="line-height: 115%;"> As for </span><span style="line-height: 115%;">the Spider Monkey and the Gibbon, I would say that the way
they move (locomotor patterns) was greatly influenced by the primates environment . If these primates were not able to hang from a tree or
able to swing from branch to branch and had to walk on the ground they would be
more prone to being eaten by a bigger predator. This would be of a great deal of problems for these primates due to their small size. With the ability to hang
from the trees and swing from the branches they are able to stay up in the high
trees and keep themselves safe from the predators on the ground, </span><span style="line-height: 18px;">surviving</span><span style="line-height: 115%;"> within the forest.</span></i></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i style="line-height: 115%;"></i></span><br />
<div style="text-align: left;">
</div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i style="line-height: 115%;">
<span style="background-color: white;"></span></i></span><br />
<div style="text-align: left;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><i style="line-height: 115%;"><span style="background-color: white;"> <i style="background-color: white; line-height: 115%;">For the Chimpanzee, I would say that the locomotion trait has
been adapted to the environment. Chimpanzees are primates that can change due to their environment rather quickly. The way they move, easily adjusts to the living conditions. Chimpanzee’s are able to walk on all fours or if they
need to carry food or something else they are able to walk on two of their
limbs. Chimpanzees are also able to climb trees and suspend themselves
from branches. I think the chimpanzees locomotion trait works to their
advantage since they are able to adapt easily to any environment that they are
in, they find a way of survival.</i></span></i></span></div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i style="line-height: 115%;"><span style="background-color: white;">
</span><span style="background-color: white;"></span></i></span><br />
<div style="text-align: left;">
</div>
<span style="font-family: Georgia, 'Times New Roman', serif;"><i style="line-height: 115%;"><span style="background-color: white;">
</span><span style="background-color: white;"><div style="text-align: left;">
<i style="background-color: white; line-height: 115%;">Baboons walk on all fours and their digits which is the tips of
their toes and the knuckles of their hands. This locomotion trait, I
believe has helped the baboons keep their hands and the soles of their
feet from becoming to rough since they are not able to climb trees or hang from
branches. </i></div>
</span><span style="background-color: white;"><div style="text-align: left;">
</div>
</span><span style="background-color: white;"><div style="text-align: left;">
<i style="background-color: white; line-height: 115%;">Lemurs adapted to their environment rather well considering they are either on the ground or in the trees the locomotion movement of Lemurs
has adapted well to their environment. They are able to move on the
ground very rapidly and if need be can leap into the trees and have great
balance.</i></div>
</span><span style="background-color: white;"><div style="text-align: left;">
</div>
</span><span style="background-color: white;"><div style="text-align: left;">
<i style="background-color: white; line-height: 115%;">I would say that the influence the environment has on physical
and behavioral traits has a huge impact. I say this because we adapt to
whatever situation or wherever we are so that we are compatible with what we
are doing. I believe the same is for primates. The primates adapted
to the environment that they were dealt. Some primates got pushed out of
their natural environment and was relocated to a new one. With the new
environment comes new issues, such as types of food, shelter, and the make up
of the ground. The primates learned how to walk to keep their feet and
hands from becoming to rough and other primates figured out how to leap into
the higher trees or keep their balance on a slimmer tree branch. The
environment impacts our traits immensely. </i></div>
</span></i></span></div>
<div style="text-align: left;">
<div style="text-align: -webkit-auto;">
<span style="font-family: Georgia, 'Times New Roman', serif;"><br /></span></div>
</div>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com5tag:blogger.com,1999:blog-3122239009936088506.post-39734782993824862312012-06-28T19:06:00.002-07:002012-06-28T23:08:37.850-07:00Homologous and Analogous<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: large; font-weight: normal;"><i><u>Homologous Structures</u></i></span></h3>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgWXZixpf82q5D0ijMVoSHaKKtpZq4hbIoE6z0ghoK9P3ZUUUnMNEPrKrsHJ-VTxgZfUxLqoy8qassrT-I0GwpC5ojjW4KENaA4ocJJTSNySsO6EvlGN4KHSecXBpN_23l4g5ElqL8pqM4/s1600/anthro1.JPG" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><span style="font-family: inherit;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEgWXZixpf82q5D0ijMVoSHaKKtpZq4hbIoE6z0ghoK9P3ZUUUnMNEPrKrsHJ-VTxgZfUxLqoy8qassrT-I0GwpC5ojjW4KENaA4ocJJTSNySsO6EvlGN4KHSecXBpN_23l4g5ElqL8pqM4/s320/anthro1.JPG" width="320" /></span></a></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCud4KlwoicxiOkMp5OuRK3C1i49Eo3ddRUpkio3ntquy7VjMI1OIutK3-nUvenDJQ85_8hpsgdZcecWgnr6hyphenhyphenZ27dG2m22uL8TyFyKS_yzdIRB2uLhvs2CP_lg85LVjZ5AAPcQD_3k_0/s1600/anthro2.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><span style="font-family: inherit;"><img border="0" height="237" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjCud4KlwoicxiOkMp5OuRK3C1i49Eo3ddRUpkio3ntquy7VjMI1OIutK3-nUvenDJQ85_8hpsgdZcecWgnr6hyphenhyphenZ27dG2m22uL8TyFyKS_yzdIRB2uLhvs2CP_lg85LVjZ5AAPcQD_3k_0/s320/anthro2.jpg" width="320" /></span></a></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjY6Wz5m4fnmJQFmeMcp3plxLul5dhnKXv_PZS70HPadOJb-Fhu177_L_OoAkjI5nZbdo_4HR-kQwVfVELI5FxWbIRD4QWrdpV2pYkTGUO2IYLFd77NX87sKj4POZ5g0-jUGFrsihYI-6c/s1600/anthro3.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><span style="font-family: inherit;"><img border="0" height="213" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjY6Wz5m4fnmJQFmeMcp3plxLul5dhnKXv_PZS70HPadOJb-Fhu177_L_OoAkjI5nZbdo_4HR-kQwVfVELI5FxWbIRD4QWrdpV2pYkTGUO2IYLFd77NX87sKj4POZ5g0-jUGFrsihYI-6c/s320/anthro3.jpg" width="320" /></span></a></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7YXnbzJZq77aaW15SO5-Ua9MUQuO8tDTZLGQewWiIXUNGD_r0x27FHHe4wbIPeZUUG2jSjRxY-LOTr-cNJUMkv4BNNp_92jwsjGzfrr0I3DlaPTwjXW-tdXGM7FFBjQBg33uZNLc9Jx8/s1600/anthro4.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><span style="font-family: inherit;"><img border="0" height="180" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEi7YXnbzJZq77aaW15SO5-Ua9MUQuO8tDTZLGQewWiIXUNGD_r0x27FHHe4wbIPeZUUG2jSjRxY-LOTr-cNJUMkv4BNNp_92jwsjGzfrr0I3DlaPTwjXW-tdXGM7FFBjQBg33uZNLc9Jx8/s320/anthro4.jpg" width="320" /></span></a></div>
<div style="text-align: center;">
<i style="background-color: white;"><span style="background-color: white; font-family: inherit;"></span></i><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white; font-family: inherit;"><br /></span></span></i></div>
</div>
</div>
</div>
<span style="font-family: inherit;"><br /></span><br />
<i style="background-color: white;"><span style="background-color: white; font-family: inherit;"></span></i><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white; font-family: inherit;">It’s
obvious enough to say that the homologous structure that these animals have is
a hand, wing, flipper or paw. All in which help them live and do
everything our human hand would personally need as well. As a human, we
know that our hands are very important and everything we do incorporates
the use of them.</span></span></i></div>
</div>
</div>
</div>
<span style="font-family: inherit;"><br /></span><br />
<i style="background-color: white;"><span style="background-color: white; font-family: inherit;"></span></i><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white; font-family: inherit;">Organs
as different as a bat's wing, a seal's flipper, a cat's paw and a human's hand
have a <u1:p></u1:p>common underlying structure, with identical or very
similar arrangements of bones and muscles. In 1843 Richard Owen reasoned that
there must be a common structural plan for all vertebrates, as well as for
each class of vertebrates. He called this plan the archetype. Richard Owen
also distinguished homology from analogy, which he defined as a 'part or organ
in one animal which has the same function as another part or organ in a
different animal'.</span></span></i></div>
</div>
</div>
</div>
<span style="font-family: inherit;"><br /></span><br />
<i style="background-color: white;"><span style="background-color: white; font-family: inherit;"></span></i><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white; font-family: inherit;">Homologous
structures are structures that are derived from a common ancestor; they
have a </span></span></i></div>
</div>
</div>
</div>
<i style="background-color: white;"><span style="background-color: white; font-family: inherit;"></span></i><br />
<span style="font-family: inherit;"></span><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<span style="font-family: inherit;"><i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white;">common
evolutionary ancestry. This is not to say that homologous structures have the
same </span></span></i></span></div>
</div>
</div>
</div>
<span style="font-family: inherit;">
<i style="background-color: white;"><span style="background-color: white;">
</span></i><i style="background-color: white;"><span style="background-color: white;"></span></i></span><br />
<div style="display: inline !important;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important; margin: 0in;">
<div style="display: inline !important;">
<span style="font-family: inherit;"><i style="background-color: white;"><span style="background-color: white;"><span style="background-color: white;">function,
a whale's flipper is homologous to a human arm. These limbs are superficially
different, but their internal skeletal structure is essentially the
same. </span></span></i></span></div>
</div>
</div>
</div>
</div>
<span style="background-color: white; font-family: inherit;"><i>
</i></span><br />
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>Bat's Wing</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>Helping them fly, allowing bats to maneuver more quickly and more accurately than birds. </i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>Seal Fin</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>On land, the use the flippers to drag hind limbs and in the water, using primarily </i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>their hind flippers for propulsion and their front flippers as rudders for steering.</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>
Cat Paw</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>Cat's walk on their toes, providing sure footing for their hind paws when they </i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>navigate rough terrain. Also any other necessity a human hand can do, a paw is able.</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>
Human Hand</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>As human's we use our hands to do every action in our lives. As human's life would be extremely </i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>hard and nearly impossible to do much without such a limb. </i></span></h3>
<div>
<div style="line-height: 16.75pt; text-indent: .5in;">
<i><span style="font-family: inherit;"><o:p></o:p></span></i></div>
<div style="line-height: 16.75pt; text-indent: .5in;">
<i><span style="font-family: inherit;"><o:p></o:p></span></i></div>
</div>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: large;"><i>Common Ancestor:</i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>A common ancestor amongst all these animals would have to be a mammal. Mammal's all need </i></span></h3>
<h3 style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i>some type of limb to have multi-functions as in this does.</i></span></h3>
<div>
<h3>
<div style="text-align: center;">
<u><span style="font-family: inherit;"><span style="background-color: white;"><span style="font-size: large;"><i>Analogous</i></span></span><i style="background-color: white; font-size: x-large;"> Structure</i></span></u><br />
<u><span style="font-family: inherit;"><i style="background-color: white; font-size: x-large;"><br /></i></span></u><br />
<i style="background-color: white;"><span style="font-family: inherit; font-size: small;">Octopus Eye vs Human Eye</span></i>
<br />
<u><span style="font-family: inherit;"><i style="background-color: white; font-size: x-large;"><br /></i></span></u><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhPwR3DgaaHEbsNGwM7uos2I8WvIcbr8CNmXqpZUhLehmfDn1GUCPSvze6OSMzIgmcLbSpeG5NckAROQ0zkNf3wa3nRqix8kYiKb9ZVZ_Yo7nTmpn0EjPVkuMq87BRVs_ZjfJ36puepnsM/s1600/anthro14.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="212" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEhPwR3DgaaHEbsNGwM7uos2I8WvIcbr8CNmXqpZUhLehmfDn1GUCPSvze6OSMzIgmcLbSpeG5NckAROQ0zkNf3wa3nRqix8kYiKb9ZVZ_Yo7nTmpn0EjPVkuMq87BRVs_ZjfJ36puepnsM/s320/anthro14.jpg" width="320" /></a></div>
</div>
<div style="font-size: x-large; text-align: center;">
<i style="background-color: white;"><span style="font-family: inherit;"><br /></span></i></div>
<span style="font-family: inherit; font-size: small;"><div style="text-align: center;">
<i style="background-color: white;">Octopus Eye</i></div>
</span></h3>
</div>
<div>
<span style="font-family: inherit; font-size: small;"><i>Cephalopods as active marine predators, possess sensory organs specialized for use in aquatic conditions. They have a camera-type eye, which consists of a lens projecting an image onto a retina. Unlike the vertebrae camera eye, the cephalopod's form as invaginations of the body surface, and consequently they lack a cornea. A cephalopod eye is focused through movement, much like the lens of a camera or telescope, rather than changing shape as the lens in the human eye does. The eye is approximately spherical, as is the lens, which is fully internal. </i></span></div>
<div>
<span style="font-family: inherit; font-size: small;"><i><br /></i></span><br />
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzuikBpHZ9IIXoXH1g6QRdSrYlsUfIjTLbAEQxyO0fwvoRBTZNjLymzRdH5XnsyiB-XYSAbTB99kr_nJUHoCIX0GoqCmcPxv13KE34rPhS_tCbSGjDL4npI-nPVQIyx44DNYEtjt4gUko/s1600/anthro15.jpg" imageanchor="1" style="margin-left: 1em; margin-right: 1em;"><img border="0" height="232" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjzuikBpHZ9IIXoXH1g6QRdSrYlsUfIjTLbAEQxyO0fwvoRBTZNjLymzRdH5XnsyiB-XYSAbTB99kr_nJUHoCIX0GoqCmcPxv13KE34rPhS_tCbSGjDL4npI-nPVQIyx44DNYEtjt4gUko/s320/anthro15.jpg" width="320" /></a></div>
<span style="font-family: inherit; font-size: small;"><i><br /></i></span><br />
<div style="text-align: center;">
<span style="font-family: inherit; font-size: small;"><i><b>Human Eye</b></i></span></div>
<span style="font-family: inherit; font-size: small;"><i><br /></i></span></div>
<div>
<span style="font-family: inherit; font-size: small;"><i>The human eye is an organ which reacts to light for several purposes. As a conscious sense organ, the mammalian eye allows vision. Rod and cons cells in the retina allow conscious light perception and vision including color differentiation and the perception of depth. The human eye can distinguish about 10 million colors. In common with the eyes of other mammals, the human's eye non-image-forming photosenitive ganglion cells in the retina receive the light signals which affect adjustment of the size of the pupil, regulation, and suppression of the hormone melatonin and entrainment of the body clock.</i></span></div>
<div>
<h3 style="text-align: center;">
<span style="color: #0d0e00; font-size: small;"><span style="font-family: inherit; line-height: 32px;"><i>Analogous Trait</i></span></span></h3>
<div>
<div class="MsoNormal">
<span style="background-color: white; font-size: 12pt; line-height: 115%;"><span style="font-family: inherit;"><i>Something known as the "camera
eye" is what the octopus eye and the human eyes both evolved from. The
name "camera eye" came from consisting of a lens projecting
a representation onto a retina. The common ancestor of the octopus
and of man possessed this analogous trait and modified it so it could
see.</i></span></span><span style="color: white; font-family: 'Times New Roman', serif; font-size: 12pt; line-height: 115%;"><o:p></o:p></span></div>
</div>
<div>
<div class="MsoNormal">
<span style="font-family: inherit; line-height: 200%;"><i><o:p></o:p></i></span></div>
</div>
<h3 style="text-align: center;">
<span class="apple-converted-space" style="font-family: inherit; font-size: small;"><i>Common Ancestors:</i></span></h3>
<div>
<span class="apple-converted-space" style="font-family: inherit; font-size: small;"><i>Their common ancestor lived more than one-half billion years ago. Since it did not have a camera-like eye (like they now do), the fact that humans exchange a simple gaze with octopuses can only mean that such an eye evolved independently. This is a classic example of parallel evolution, the emergence of a similar biological feature, not be a descent from a common ancestor. But from organisms that are effectively unrelated. Yet biologists also know that this eye-type has evolved independently at least four other times. Both octopus and humans end up seeing in much the same way, even though their respective ancestors could not.</i></span></div>
<div class="MsoNormal" style="line-height: 200%;">
<o:p></o:p></div>
</div>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com7tag:blogger.com,1999:blog-3122239009936088506.post-25606703363449787922012-06-20T23:37:00.002-07:002012-06-20T23:37:16.222-07:00Apes Evolving into Students?<h3>
<span style="font-weight: normal;">Can you <i>decode me</i>? Lets see if I understand mRNA to DNA.</span></h3>
<h3>
<span style="font-weight: normal;"><br /></span><span style="font-weight: normal;">ATTGAAATGCCAAGTGAGCTCAGCTAGGTAAGCCG</span></h3>
<div>
<span style="font-weight: normal;"><br /></span></div>
<div class="separator" style="clear: both; text-align: center;">
<a href="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjUFiCkRgOIsKd_c_2hDWWGs6a52Ny0kxkhue3l-2LXdPz4_wQEKR7DCOSHbADcrm06q2SQ-tY9fN_QagGT-eFufVk9EkMMebnLUBcZes5LEmjGjOJd1B7Bsw3UAHONVnEO5tg7iWG4hlA/s1600/apes.jpg" imageanchor="1" style="background-color: white; margin-left: 1em; margin-right: 1em;"><img border="0" height="240" src="https://blogger.googleusercontent.com/img/b/R29vZ2xl/AVvXsEjUFiCkRgOIsKd_c_2hDWWGs6a52Ny0kxkhue3l-2LXdPz4_wQEKR7DCOSHbADcrm06q2SQ-tY9fN_QagGT-eFufVk9EkMMebnLUBcZes5LEmjGjOJd1B7Bsw3UAHONVnEO5tg7iWG4hlA/s320/apes.jpg" width="320" /></a></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<div class="separator" style="clear: both; text-align: center;">
<br /></div>
<h2>
<br /><span style="font-weight: normal;">Beware of that start codon! Locate it! Have fun!</span></h2>
<div>
<span style="font-weight: normal;"><br /></span></div>
<div>
<span style="font-weight: normal;"><br /></span></div>Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com7tag:blogger.com,1999:blog-3122239009936088506.post-13746361241402230112012-06-16T18:16:00.002-07:002012-06-16T18:20:35.662-07:00How does Evolution work?One of the most influential philosophers that contribute to Charles
Darwin’s theory was from Charles Lyell. Lyell’s theory of geology came
from the idea of uniformitarianism. Best defined as the assumption that
the same natural processes that function in the universe now, have
always operated in the universe in the past and apply everywhere in the
universe. Lyell would conclude that Earth was made of many gradual slow
changes made into what we know today. Similar to Darwin, Lyell had a
thoughtful effect on our understanding of life's history. Lyell
influenced Darwin so intensely that Darwin viewed evolution as a sort of
biological uniformitarianism. Evolution took place from one generation
to the next, he argued, but it worked too slowly for us to perceive.<br /><br />< <a class="ot-anchor" href="http://evolution.berkeley.edu/evolibrary/article/history_12">http://evolution.berkeley.edu/evolibrary/article/history_12</a>><br /><br />How does Evolution work?<br /><br />n
order for traits to evolve and change, they MUST be heritable. This is
one of the points that I definitely find to be of Lyell’s understanding.
Darwin could not seem to find an understanding to how traits were
passed on. But from Lyell’s beliefs, he finds that over a long course of
time things change. Just like theis traits have been passed down and
eventually changing over a long course of time, producing generation
after generation.<br />If the environment changes, the traits that are
helpful or adaptive to that environment will be different. As Lyell in
his theories, mentions that He found evidence for many rises and falls
of sea level, volcanoes construct on top of much older rocks. Natural
processes such as earthquakes and eruptions, which had been witnessed by
humans, were enough to produce mountain ranges. Now only were valleys
the work from huge floods but they slowly were the grinding from a
intense force of wind and water. As the environments were changing by
natural processes, traits that were adaptive lived in the surroundings.
Lyell was a huge believer in environments naturally changing and how the
world will slowly change, only those who could adapt would survive.
Darwin must of found Lyell’s beliefs in this topic something he could
grow from.<br /><br />Darwin and Natural Selection: I do not find Charles
Darwin’s theory on natural selection to be that connected with the work
from Charles Lyell. Don’t get me wrong, I do think Charles Darwin would
not have gotten this far in his work without knowing what Lyell did
first, but I think Darwin’s thoughts on natural selection were stemmed
from his thoughts on evolution in geology that came first. From the
evolution of geology which Lyell thought took so long overtime, Darwin
interpreted that to the idea of people evolving over time.<br />The church
found that religion and science could never meet hand in hand. The book
shaped a variety of religious responses at a time of altering ideas at
this time. Developments in geology meant that there was little hostility
based on a literal reading of Genesis, but defense of the argument from
design and natural theology was central to debates over the book in the
English speaking world. The church of English interpreted the idea of
Natural Selection to be an instrument of God's design. Even though the
book had hardly implied to human evolution, it rapidly became vital to
the debate as psychological and moral qualities were seen as spiritual
aspects of the irrelevant soul, and it was believed that animals did not
have spiritual traits. This divergence could be submissive by supposing
there was some supernatural intervention on the path leading to humans,
or interpreting evolution as a decisive and progressive rise to
mankind's position at the head of nature.Anonymoushttp://www.blogger.com/profile/04723084696966795680noreply@blogger.com1