Hi Kristina!I tried to decode your strand several times and this is what I keep coming up with, let me know if I'm right...UAACUUUACGGUUCACUCGAGUCGAUCCAUUCGGC"an is from at and are sleepy about book sleep about"-I am also having trouble located the start strand. I will keep trying :)
Start strand was ATTG and ended with GCCG, so everything between there. I'm sorry, I was a little confused on the start strand aspect
Yes, you have to have those start and stop codons in there!Here was my decode:DNA: ATTGAAATGCCAAGTGAGCTCAGCTAGGTAAGCCGRNA UAACUUUACGGUUCACUCGAGUCGAUCCAUUCGGCUAAC UUU ACG GUU CAC UCG AGU CGA UCC AUU CGGC ?(missing start) In school, think about ape(s) evolv(ing) into students. (missing stop)
btw: in super confused...lol
I got a similar decode as Keyannah:An is from at and are sleepy book sleep about.By the way like your picture! makes the blog more creative.
Tatiana, if another student has already attempted a decode, you should not leave a comment. You need to find a different code to respond to.
This comment has been removed by the author.
Hi Kristina!
ReplyDeleteI tried to decode your strand several times and this is what I keep coming up with, let me know if I'm right...
UAACUUUACGGUUCACUCGAGUCGAUCCAUUCGGC
"an is from at and are sleepy about book sleep about"
-I am also having trouble located the start strand. I will keep trying :)
Start strand was ATTG and ended with GCCG, so everything between there. I'm sorry, I was a little confused on the start strand aspect
DeleteYes, you have to have those start and stop codons in there!
DeleteHere was my decode:
DNA: ATTGAAATGCCAAGTGAGCTCAGCTAGGTAAGCCG
RNA UAACUUUACGGUUCACUCGAGUCGAUCCAUUCGGC
UAAC UUU ACG GUU CAC UCG AGU CGA UCC AUU CGGC ?
(missing start) In school, think about ape(s) evolv(ing) into students. (missing stop)
btw: in super confused...lol
ReplyDeleteI got a similar decode as Keyannah:
ReplyDeleteAn is from at and are sleepy book sleep about.
By the way like your picture! makes the blog more creative.
Tatiana, if another student has already attempted a decode, you should not leave a comment. You need to find a different code to respond to.
ReplyDeleteThis comment has been removed by the author.
ReplyDelete