Human Variation! Last Post!

1.       In the colder climates, humans responses to the environment in many ways. Positively there is an increase in basal metabolic rate, fat insulation, and change in blood flow. More importantly, the negative effects are reactions such as hypothermia. Due to concentration of body heat in the torsos, there was a loss of fingers, toes to create a severe frostbite.

2.       Short-term adaptation: It is a stress with a short and quick response; it maintains homeostasis in an orderly immediate matter. An example would be shivering when the climate is cold.

Facultative adaptation: These are genetic traits that involve turning genes on/off to alter a phenotype in the environment, not a change in the DNA of the organism. As long as the stress is applied, the phenotype will be adjusted but can return to the normal mode when stress is released. Just as in when someone stands upside down, all the blood races to your head; when you return to right side up again, then the blood will return to all the appropriate places.

 Developmental adaptations: These traits can only change through long terms, generations at a time, an individual does not have the power to adjust. The long-term stress is applied with evolutionary forces. In warm climates, the people tend to be slimmer because of the heat they do not want to retain.

Cultural adaptations: Humans, with culture, can help to adapt to environmental stresses on occasion. Cultural adaptations include social behaviors, practices, tools, diet and more. An example is how we dress according to where we live.

3.       Human variation is very interesting; humans are all the same but cultural and environmental situations alter the way everyone acts, feel and treat one another. In order to understand how humans think, respond and act you must have a deeper understanding of where they come from. This can truly positively affect everyone.  For instance, I am moving to North Carolina next week. In order for me to understand that culture, I have to pay attention to what they eat, how they dress, and the different accent they have. I need to understand that their living is much slower than Los Angeles, what I’m used to. To understand other people, you need to put it into perspective.

4.       Different races are understood with the adaptation to variations. Cultural adaptations are the only adaptation that makes complete sense to me. It is defined to help adapt to the environmental stresses when necessary. This the social behaviors, tools, food, practices, and clothing; the understanding between how races are, becomes a happy median to how these cultures will adapt with others. It’s hard to explain human variation because we are all similar but with the exception of cultural environments, we tend to be very different amongst races. That needs to be very much understood.

Language Deficits

Part 1:

            I found this assignment completely difficult. Maybe it was because I have no patience, but only being able to speak with your eyes and facials is so unrealistic within communicating. I found this to be quite a tricky assignment; I am a very verbal/talkative person.            My partner had a harder time than I did in this assignment. I thought I was bad but we just couldn’t get on the same understanding level in this situation. After when we talked about what we were trying to communicate, it had nothing to do with what actually was needed to be conversed.            I feel in the situation of this “no symbolic communication”, hypothetically if it represented two different cultures, it would be very confusing. It reminds me directly of how Americans met Native Americans back in the day, making understanding between the two foreign cultures difficult. I think the symbolic language has the upper hand because language doesn’t help someone that cannot understand, facials would do better work in that case. Frustration would arise from the speaking culture because it would not do them any good, talking to someone that completely cannot comprehend what’s going on. In this case, non-verbal has a lot of power to these two diverse cultures. In our culture directly, we are a diverse state of California with many Hispanics that do not speak fluent English, if at all. That could be a big discrepancy in our system, how Americans and Hispanics cannot fully communicate to their best ability. We use multi-cultural workers in our society to our advantage at different work places. Someone who can speak both Spanish and English is a very valued gift to California worker places.

Part 2:

            I do not feel as if this type of communication was that harsh. Yes it was difficult at times but nothing like the first assignment. I use my hands a lot so multiple times I just had to sit on my hands and not wiggle my body. But using words came easier for me.            My partner as I had a decent time with this particular assignment. I don’t know but after the first part of the assignment this one came to us much easier.            I find non-speech techniques to be extremely important in society and how we communicate today. I can say it makes things easier to use those facials and point when talking specifically about something, but if two people speak the same language, you might as well us it to your fullest capabilities.            There are always those people who find difficulty in reading body language. I would say obviously this would not help blind people in any way at all, which would be completely impossible. I feel like being a people person would help someone comprehend reading body language well, it would benefit the socialable person greatly, people that come into contact with people often. Environment situations where this would not benefit the persons, this is quite a hard question. Honestly I cannot put the situation into perspective enough to find a valid example, which doesn’t give an answer. But nothing reasonable is coming to mind! Because most places using language is the easier option and using gestures is easier to go without. Maybe on a sporting field while playing a game, that could be nearly impossible not to move, use gestures or point.

WHO DONE IT?

The Piltdown hoax consisted of a man in which bone fragments were presented as the fossilized remnants of a previously unknown early human. In 1912 from a gravel pit in Piltdown, East Sussex, England; the remains of the parts were of a skull and jawbone. The collector of these bone fragments was Charles Dawson. The significance of the specimen remained the subject of controversy until it was exposed in 1953 as a forgery, consisting of the lower jawbone of an orangutan. Which has been deliberately combined with the skull of a fully developed modern human. The Piltdown hoax is perhaps the most famous paleontological hoax ever. It has been prominent for two reasons: the attention paid to the issue of human evolution, and the length of time, more than 40 years that elapsed from its discovery to its full exposure as a fake.

The Piltdown man hoax had succeeded so well because, at the time of its discovery, the scientific establishment had believed that the large modern brain had preceded the modern omnivorous diet, and the forgery had provided exactly that evidence. It has also been thought that nationalism and cultural prejudice played a role in the less-than-critical acceptance of the fossil as genuine by some British scientists. It pleased European expectations that the earliest humans would be found in Eurasia, and the British, it has been claimed, also wanted a first Briton to set against fossil hominids found elsewhere in Europe, including France and Germany.

An imperfection that our society is accustomed to human nature, we make faults more frequently than we know. In this situation concerning the hoax, one man found responsibility for the discovery; his name was Sir Arthur Conan Doyle, creation of Sherlock Holmes. Amongst his “findings”, was the idea of revenge he had amongst the scientific community because they joked of his beliefs on spiritualism. He thoroughly believed in communication with the deceased, in which this rational society did not condone. But looking back at the situation, hypothetically if this was indeed a hoax, why would he have geared a prank towards more humiliation. Another suspect was the man initially to find Charles Darwin, the philosopher known for so many important findings in science and evolution. This suspect had a lot to prove in order to climb the ladder of scientific discovery and ambition. To this day, he indeed is still the highest ranked suspect on this matter. To this day, who knows who it could really be.

It is a huge upset that this was all a hoax, but with an upside to it all, initially the science reputation was saved. Hypotheses were tested time and time again, also did the theories; they must be falsifiable and maybe even Piltdown man would come through. Giles Oakley performed all the tests on the bones to determine somewhat of an age amongst them. The bones involved were tested with chemicals to determine a particular age. It was soon determined that these bones were much younger than originally known to be. They then tested the amount of nitrogen contained, later showing us that the skull was not very old at all. Even though this forgery lastest almost forty years in the making of some truth, it was still the scientific method that eventually proved to be counterfeit.

There is no denying that human flaws are avoidable, because they are definitely inevitable. The humans we have been raised to become, will always understand errors. Human qualities that are good in the nature of us humans are amongst: trust, belief, dedication and aspiration. Without such qualities within our existence, there would be no science and testing out the uncertain. This may have been a hoax but in a more understanding sense, mistakes do occur.

Primates: Locomotor and Learning

Lemurs:

Description of where they live:             
               This type of primate, the lemur, lives amongst the trees in forests. Forest midlevel and up, is where you are most to find a lemur, except the ring-tailed lemur which is mostly on the ground level. Lemurs are usually diurnal, meaning that they are active and awake during the day, while night time is all about sleep. There are some lemurs, whom are of the smaller stature (“mouse” lemurs or “dwarves” as they are called) that are nocturnal.


Description of this primate’s character trait:
                Lemurs are herbivores, having a diet consisting of mainly leaves and fruits.  Cheirogaleidae (dwarves), a family of lemurs, has a diet of fruit and prey such as insects, frogs, etc. Indriidae, another family of lemurs, eats strictly as vegetarians. Daubentoniidae, the last of the lemur family’s, are primarily carnivorous, their prey consists of insects, eggs and birds.

Description of Primate’s trait that influences Environment:
                Many of these lemurs live high amongst the trees, making it easier and more convenient to be in reach of their food. Because they live in such tropical forest-like places, their diet consisting of fruits, plants, and small insects are easy to come by.
 

Spider Monkey:

Description of where they live:
               New world monkeys live in arboreal habitats throughout the Amazonian ecosystem and the neotropics. They occupy a variety of niches by adapting to different food sources located at different vertical levels in the forest. The resources of a particular tropical forest without directly competing.

Description of primate’s character trait:
               They play a role in the food chairs for consuming fruits and nuts. Spider Monkey’s get consumed by jaguars, harpy eagles, or small cats called ocelots. However, they are particularly effective as seed dispersers, both in terms of quantity and quality. Being a spider monkey, their diet consists of about 90 percent fruits and nuts. They eat the fruits of many big forest trees, and because it swallows fruits whole, the seeds will eventually pass out. Spider monkeys are diurnal and most of the feeding happens between dawn and 10 am. After the morning feeding, the adults typically rest while the young play. Throughout the rest of the day, they may feed infrequently around 10pm or so. If their food is low, they can always resort to eating insects, bark, and rotting forest, and honey. The spider monkey has a unique way of getting food because there is a lead female responsible for feeding. If she cannot find enough food for the entire group, they split into smaller ones to find food easier.

Describe the Primate’s trait influencing environment:
                Spider Monkeys live in forest areas, mostly within the Central and South American areas, they can adapt to different fruits found amongst forests in order to compete for food to survive. They also eat the insects that they found in the leaves that they eat, so there is ways of changing and adapting to their eating, although they are known for eating almost anything. The main problem that they are facing is the competiting of the same kind of fruit amongst one another.

Baboon:

Description of Primates Living Arrangements:
               These monkeys are widely distributed in the Old World from southern Europe into NW Africa; throughout Africa south of the Sahara; and through central and Asia. Including Southern China and most of Japan as well. Some Ceropithecids show greater tolerance for cold than any other non-human primates; one macaque inhabits the cold and snowy regions of northern Japan. The steep side of gorges among the open, uplands of Ethiopian highlands at altitudes of 2000 to 4000m. The climate is mostly cool with heavy rainfall from June to September and very little at other times. Mainly only grasses and stunted vegetation can survive the cold nights and periods of drought. The earliest records of ceropithecids are from the Oligocene of Egypt. All fossil records are from the Old World, matching the distribution of modern species. Some extinct species were huge; one nearly reached the side of a gorilla!

Description of Character Trait of Primate:
               Ceropithecids are divided into two ecologically and morphologically distinct subfamilies. The Ceropithecines are omnivorous, have cheek pouches, and simple stomachs; while the colobines are folivorous, lack cheek pouches, and have very much complex stomach. Other sources of food such as acacia leaves, cultivates seed crops and fruit, represent only about five percent of its diet. Shortly after dawn, the feladas leave their rocky gorges an clamber up onto open grasslands to graze. Since the food they eat is of such low quality, they much forage all day to meet their energy requirements.

How Primate’s trait influences its direct environment:
                Since the kind of primate lives mostly in cold areas, it has adapted better in this kind of climate, fruits and seeds crops only represents a little part of their diet. It is easy to understand why since in this kind of climate, seeds and fruits are not easy to come by. This is why in order to get their main source of energy they eat grass because it is easily found. In a way that is why they have developed such complex stomachs so they can basically eat whatever is found.
  

Gibbons:

Description of Primate Environment:
                Gibbons are found in tropical forests of southeastern Asia, they prefer the upper forest canopy. Amongst them is where fruits are abundant and spread branches allowing for continuous travels. They also thrive in surviving areas of forests that have been logged.

Description of Character Trait of Primate:
                They are primarily vegetation, feeding on figs and other fruits, leaves and shoots. Gibbons are omnivorous animals meaning that they eat a mixture of both plant and animal matter. The main food of the gibbon is ripe fruit which grow around them in the trees, and makes up around three quarters of the gibbon’s diet. Gibbons also prey on insects, eggs, spiders and small birds.

Discussion on Primate’s trait to Influencing Environment:
                Gibbons have developed long arms to move from one tree to another in order to get the fruits that constitute the most important part of their diet. They can also move pretty fast so they are predator also for insects, spiders, and small birds. They live in tropical environments so they can get the fruit, and develop a good flexibility to reach the top of trees.

Chimpazee:

Desciption of Primate’s Enviroment:
                Chimpanzee’s live in a wide variety of habitats, including tropical rain forests, woodlands, swamp forests, and glasslands amongst Western Africa. The different subspecies of chimpanzees live in different parts of Western and Central Africa in 21 different countries, from the Atlantic coast to well inland.

Description of Primate’s Character Trait:
                Hominids are omnivorous, primarily frugivorous or folivorous. Chimpanzees are omnivores, eating plants and meat. They forages for food in the forests during the day, eating leaves, fruit, seeds, tree bark, plant bulbs and more. They also enjoy eating termites, ants and other small animals. Chimpanzees drink water, often by using a chewed leaf as a sponge to sop up the water.

Discussion on Primate’s influence to the Environment:
                Since chimpanzees are one of the biggest yet strongest of the primates, it is not weird that they even are able to eat young monkeys. This big size also has an impact on the type of fruit they can get and that is why there are omnivorous in comparison with smaller primates; that they can only live of fruits and seeds because they can move from tree to tree more easily. The fruits are part of their diets since their common habitat are tropical forest, also where they can be easily found.

Locomotor Patterns

Lemurs:

            For the most part, Lemurs are quadrupedal, meaning they walk on all fours. However, they are also well-known leapers and climbers.

           

Spider Monkeys:

           There are many different types of locomotion that spider monkeys may use. The type of locomotion is quadrupedal, which is using all four limbs to walk or run. Then there is the suspensory locomotion, which is used when hanging, climbing or moving through trees.

Baboon:

         Baboons locomotor pattern is a quadrupedal and on their digits. Walking on their digits specifically means to walk on their toes with the heels not touching the ground. This is known as being a digitigrades quadrupedalism.

Gibbon:

            Gibbons main locomotor patter is brachiating. When gibbons brachiates, they use four fingers of their hands like a hook; they do not use their thumbs. Gibbons are known for being very acrobatic and agile. Givvnos lives are spent mainly in trees. It is very rate for a gibbon to be on the ground but when they are, they walk bipedally, on two legs. Gibbons do not know how to swim, so they avoid water as best as they can. Gibbons are also able to walk along small branches, high up in the air and stretch their arms out to help them keep their balance.

Chimpanzee:

            Chimpanzees usually walk on all fours, which mean they walk on the sides of their feels and the knuckles of their hands. However, chimpanzees can always walk upright, meaning they will walk on their feet when they need to use their arms to carry something. Chimpanzees are also known for their ability to swing from branch to branch in the trees, which is known as brachiating.

Homologous and Analogous

Homologous Structures

It’s obvious enough to say that the homologous structure that these animals have is a hand, wing, flipper or paw. All in which help them live and do everything our human hand would personally need as well. As a human, we know that our hands are very important and everything we do incorporates the use of them.

Organs as different as a bat's wing, a seal's flipper, a cat's paw and a human's hand have a common underlying structure, with identical or very similar arrangements of bones and muscles. In 1843 Richard Owen reasoned that there must be a common structural plan for all vertebrates, as well as for each class of vertebrates. He called this plan the archetype. Richard Owen also distinguished homology from analogy, which he defined as a 'part or organ in one animal which has the same function as another part or organ in a different animal'.

Homologous structures are structures that are derived from a common ancestor; they have a 

common evolutionary ancestry. This is not to say that homologous structures have the same 

function, a whale's flipper is homologous to a human arm. These limbs are superficially different, but their internal skeletal structure is essentially the same. 

Bat's Wing

Helping them fly, allowing bats to maneuver more quickly and more accurately than birds. 

Seal Fin

On land, the use the flippers to drag hind limbs and in the water, using primarily 

their hind flippers for propulsion and their front flippers as rudders for steering.

Cat Paw

Cat's walk on their toes, providing sure footing for their hind paws when they 

navigate rough terrain. Also any other necessity a human hand can do, a paw is able.

Human Hand

As human's we use our hands to do every action in our lives. As human's life would be extremely 

hard and nearly impossible to do much without such a limb. 

Common Ancestor:

A common ancestor amongst all these animals would have to be a mammal. Mammal's all need 

some type of  limb to have multi-functions as in this does.

Analogous Structure


Octopus Eye vs Human Eye

Octopus Eye

Cephalopods as active marine predators, possess sensory organs specialized for use in aquatic conditions. They have a camera-type eye, which consists of a lens projecting an image onto a retina. Unlike the vertebrae camera eye, the cephalopod's form as invaginations of the body surface, and consequently they lack a cornea. A cephalopod eye is focused through movement, much like the lens of a camera or telescope, rather than changing shape as the lens in the human eye does. The eye is approximately spherical, as is the lens, which is fully internal. 

Human Eye

The human eye is an organ which reacts to light for several purposes. As a conscious sense organ, the mammalian eye allows vision. Rod and cons cells in the retina allow conscious light perception and vision including color differentiation and the perception of depth. The human eye can distinguish about 10 million colors. In common with the eyes of other mammals, the human's eye non-image-forming photosenitive ganglion cells in the retina receive the light signals which affect adjustment of the size of the pupil, regulation, and suppression of the hormone melatonin and entrainment of the body clock.

Analogous Trait

Something known as the "camera eye" is what the octopus eye and the human eyes both evolved from. The name "camera eye" came from consisting of a lens projecting a representation onto a retina. The common ancestor of the octopus and of man possessed this analogous trait and modified it so it could see.

Common Ancestors:

Their common ancestor lived more than one-half billion years ago. Since it did not have a camera-like eye (like they now do), the fact that humans exchange a simple gaze with octopuses can only mean that such an eye evolved independently. This is a classic example of parallel evolution, the emergence of a similar biological feature, not be a descent from a common ancestor. But from organisms that are effectively unrelated. Yet biologists also know that this eye-type has evolved independently at least four other times. Both octopus and humans end up seeing in much the same way, even though their respective ancestors could not.

Apes Evolving into Students?

Can you decode me? Lets see if I understand mRNA to DNA.

ATTGAAATGCCAAGTGAGCTCAGCTAGGTAAGCCG

Beware of that start codon! Locate it! Have fun!

How does Evolution work?

One of the most influential philosophers that contribute to Charles Darwin’s theory was from Charles Lyell. Lyell’s theory of geology came from the idea of uniformitarianism. Best defined as the assumption that the same natural processes that function in the universe now, have always operated in the universe in the past and apply everywhere in the universe. Lyell would conclude that Earth was made of many gradual slow changes made into what we know today.  Similar to Darwin, Lyell had a thoughtful effect on our understanding of life's history. Lyell influenced Darwin so intensely that Darwin viewed evolution as a sort of biological uniformitarianism. Evolution took place from one generation to the next, he argued, but it worked too slowly for us to perceive.

< http://evolution.berkeley.edu/evolibrary/article/history_12>

How does Evolution work?

n order for traits to evolve and change, they MUST be heritable. This is one of the points that I definitely find to be of Lyell’s understanding. Darwin could not seem to find an understanding to how traits were passed on. But from Lyell’s beliefs, he finds that over a long course of time things change. Just like theis traits have been passed down and eventually changing over a long course of time, producing generation after generation.
If the environment changes, the traits that are helpful or adaptive to that environment will be different. As Lyell in his theories, mentions that He found evidence for many rises and falls of sea level, volcanoes construct on top of much older rocks. Natural processes such as earthquakes and eruptions, which had been witnessed by humans, were enough to produce mountain ranges. Now only were valleys the work from huge floods but they slowly were the grinding from a intense force of wind and water. As the environments were changing by natural processes, traits that were adaptive lived in the surroundings. Lyell was a huge believer in environments naturally changing and how the world will slowly change, only those who could adapt would survive. Darwin must of found Lyell’s beliefs in this topic something he could grow from.

Darwin and Natural Selection: I do not find Charles Darwin’s theory on natural selection to be that connected with the work from Charles Lyell. Don’t get me wrong, I do think Charles Darwin would not have gotten this far in his work without knowing what Lyell did first, but I think Darwin’s thoughts on natural selection were stemmed from his thoughts on evolution in geology that came first. From the evolution of geology which Lyell thought took so long overtime, Darwin interpreted that to the idea of people evolving over time.
The church found that religion and science could never meet hand in hand. The book shaped a variety of religious responses at a time of altering ideas at this time. Developments in geology meant that there was little hostility based on a literal reading of Genesis, but defense of the argument from design and natural theology was central to debates over the book in the English speaking world. The church of English interpreted the idea of Natural Selection to be an instrument of God's design. Even though the book had hardly implied to human evolution, it rapidly became vital to the debate as psychological and moral qualities were seen as spiritual aspects of the irrelevant soul, and it was believed that animals did not have spiritual traits. This divergence could be submissive by supposing there was some supernatural intervention on the path leading to humans, or interpreting evolution as a decisive and progressive rise to mankind's position at the head of nature.